IthaID: 3418


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs189984760 HGVS Name: NG_011968.1:g.47126T>C

Context nucleotide sequence:
ATAACAAGGAGAAGTCTGAATTAAA [A>G] GAACTCGCCAATTTGGGAAGTAATG (Strand: +)

Also known as:

Comments: SNP associated with high HbF levels in β-thalassaemia intermedia patients from the Chinese Zhuang population.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 2
Locus: NG_011968.1
Locus Location: 47126
Size: 1 bp
Located at: BCL11A
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese Zhuang
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Lai Y, Chen Y, Chen B, Zheng H, Yi S, Li G, Wei H, He S, Zheng C, Genetic Variants at BCL11A and HBS1L-MYB loci Influence Hb F Levels in Chinese Zhuang β-Thalassemia Intermedia Patients., Hemoglobin, 40(6), 405-410, 2016
Created on 2019-05-27 15:38:36, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.