IthaID: 3416
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs12477097 | HGVS Name: | NG_011968.1:g.87237T>G |
Context nucleotide sequence:
CTCTGCTTCCCCTGCAGAATTAGACAGCTA [A>C] AAACATTTCTATCAGCCTAAGAAGCTATTT (Strand: +)
Also known as:
Comments: SNP associated with HbF levels (positive effect) in Chinese β-thalassaemia heterozygotes [PMID: 21385855]. SNP was found to have a significant effect on HbF levels in a meta-analysis of many GWAS with a total of 2040 sickle cell anaemia patients from 7 cohorts (e.g., CSSCD, MSH, PUSH, Walk-PHaSST and SIT) [PMID: 22936743].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_011968.1 |
| Locus Location: | 87237 |
| Size: | 1 bp |
| Located at: | BCL11A |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Chinese, African-American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Farrell JJ, Sherva RM, Chen ZY, Luo HY, Chu BF, Ha SY, Li CK, Lee AC, Li RC, Li CK, Yuen HL, So JC, Ma ES, Chan LC, Chan V, Sebastiani P, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, A 3-bp deletion in the HBS1L-MYB intergenic region on chromosome 6q23 is associated with HbF expression., Blood , 117(18), 4935-45, 2011
- Bae HT, Baldwin CT, Sebastiani P, Telen MJ, Ashley-Koch A, Garrett M, Hooper WC, Bean CJ, Debaun MR, Arking DE, Bhatnagar P, Casella JF, Keefer JR, Barron-Casella E, Gordeuk V, Kato GJ, Minniti C, Taylor J, Campbell A, Luchtman-Jones L, Hoppe C, Gladwin MT, Zhang Y, Steinberg MH, Meta-analysis of 2040 sickle cell anemia patients: BCL11A and HBS1L-MYB are the major modifiers of HbF in African Americans., Blood , 120(9), 1961-2, 2012
Created on 2019-05-23 17:08:26,
Last reviewed on 2019-05-24 09:44:27 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.