IthaID: 341
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | Init CD ATG>GTG | HGVS Name: | HBA1:c.1A>G |
| Hb Name: | N/A | Protein Info: | α1 nt 38 A>G |
Context nucleotide sequence:
CCCACAGACTCAGAGAGAACCCACC [A/G] TGGTGCTGTCTCCTGCCGACAAGAC (Strand: +)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37580 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Initiation codon (Translation) |
| Ethnic Origin: | Mediterranean, Sardinian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Paglietti E, Galanello R, Moi P, Pirastu M, Cao A, Molecular pathology of haemoglobin H disease in Sardinians., Br. J. Haematol. , 63(3), 485-96, 1986
- Moi P, Cash FE, Liebhaber SA, Cao A, Pirastu M, An initiation codon mutation (AUG----GUG) of the human alpha 1-globin gene. Structural characterization and evidence for a mild thalassemic phenotype., The Journal of clinical investigation, 80(5), 1416-21, 1987
Created on 2010-06-16 16:13:15,
Last reviewed on 2014-04-08 17:04:16 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.