IthaID: 3405


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: CD 47-53 (-20bp): (-GACCTGAGCCACGGCTCTGC) HGVS Name: HBA2:c.142_161del
Hb Name: N/A Protein Info: α2 47 - 53 (-GACCTGAGCCACGGCTCTGC); modified C-terminal sequence

Context nucleotide sequence:
CTACTTCCCGCACTTC [GACCTGAGCCACGGCTCTGC/-] CCAGGTTAAGGGCCAC (Strand: +)

Also known as:

Comments: The 20 nt deletion creates a frameshift and a premature termination codon and would probably undergo nonsense-mediated decay, causing a thalassemic phenotype.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34034
Size: 20 bp
Located at: α2
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Norwegian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Grimholt RM, Fjeld B, Klingenberg O, Hemoglobinopathy gone astray-three novel forms of α-thalassemia in Norwegian patients characterized by quantitative real-time PCR and DNA sequencing., Scand J Clin Lab Invest, 2021
Created on 2019-04-12 09:45:47, Last reviewed on 2022-07-12 12:01:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.