IthaID: 3400


Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 147 TAA>CAA [Stop>Gln] HGVS Name: HBB:c.442T>C
Hb Name: Hb Zunyi Protein Info: β 147, Stop>Gln; modified C-terminal sequence: (147)Gln-Ala-Arg-Phe-Leu-Ala-Val-Gln-Phe-Leu-Leu- Lys-Val-Pro-Leu-Phe-Pro-Lys-Ser-Asn-(167)Tyr-COOH

Context nucleotide sequence:
CTAATGCCCTGGCCCACAAGTATCAC [T/C] TAAGCTCGCTTTCTTGCTGTCCAA (Strand: -)

Comments: Reported as a de novo mutation in a young transfusion-dependent patient with severe hemolytic anaemia. This mutation results in a stop-codon substitution to a glutamine residue and an increase of 21 amino-acids in the beta-globin chain. Leads to a dominant beta-thalassemia state according to this case report.

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72016
Size: 1 bp
Located at: β
Specific Location: Exon 3

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Dominant
Stability: Hyperunstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Chinese
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Unknown

Publications / Origin

  1. Su Q, Chen S, Wu L, Tian R, Yang X, Huang X, Chen Y, Peng Z, Chen J, Severe Thalassemia Caused by Hb Zunyi [β147(HC3)Stop→Gln; : c.442T>C)] on the β-Globin Gene., Hemoglobin, 43(1), 7-11, 2019
Created on 2019-04-11 16:33:29, Last reviewed on 2019-06-11 09:38:03 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.