IthaID: 3396


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: IVS I-113 C>A HGVS Name: HBA2:c.96-5C>A
Hb Name: Hb Beach Haven Protein Info: N/A

Context nucleotide sequence:
CCCCACCCCTCACTCTGCTTCTCCC [C/A] GCAGGATGTTCCTGTCCTTCCCC (Strand: +)

Also known as:

Comments: Found in cis with -α3.7 in a 2-year-old Filipino proband with Hb H disease (--FIL/-α3.7). The variant is within the α2-globin part of the hybrid α2α1 gene generated. It creates a new 3' acceptor splice site in the IVS I of the α2-globin gene, three nucleotides upstream of the wild-type splice site. Because this is in frame, any transcript produced using this site will insert a serine into helix B of the α-globin protein chain at codon position 31, possibly destabilizing the α1β1 interface. Although the new acceptor splice site is the first AG, it is not used preferentially over the wild-type site. The new acceptor splice site is used in ~35% of α-globin mRNA transcripts. As a result, the lowered expression of normal α-globin transcript from this allele predicts for a more severe form of Hb H disease in the proband.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: N/A
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: N/A
Size: 1 bp
Located at: α3.7 hybrid
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Consensus splice site (mRNA Processing)
Ethnic Origin: Filipino
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Van de Water N, Tan T, Crowley M, Kerr R, Browett P, Novel α-Globin Splice Site Mutation (HBA2: c.96-5C>A) in Combination with Three-Gene Deletion Hb H Disease., Hemoglobin, 42(2), 122-125, 2018
Created on 2019-04-11 15:07:29, Last reviewed on 2021-03-09 10:46:44 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.