IthaID: 3396
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | IVS I-113 C>A | HGVS Name: | HBA2:c.96-5C>A |
| Hb Name: | Hb Beach Haven | Protein Info: | N/A |
Context nucleotide sequence:
CCCCACCCCTCACTCTGCTTCTCCC [C/A] GCAGGATGTTCCTGTCCTTCCCC (Strand: +)
Also known as:
Comments: Found in cis with -α3.7 in a 2-year-old Filipino proband with Hb H disease (--FIL/-α3.7). The variant is within the α2-globin part of the hybrid α2α1 gene generated. It creates a new 3' acceptor splice site in the IVS I of the α2-globin gene, three nucleotides upstream of the wild-type splice site. Because this is in frame, any transcript produced using this site will insert a serine into helix B of the α-globin protein chain at codon position 31, possibly destabilizing the α1β1 interface. Although the new acceptor splice site is the first AG, it is not used preferentially over the wild-type site. The new acceptor splice site is used in ~35% of α-globin mRNA transcripts. As a result, the lowered expression of normal α-globin transcript from this allele predicts for a more severe form of Hb H disease in the proband.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | N/A |
| Allele Phenotype: | N/A |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | α3.7 hybrid |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Consensus splice site (mRNA Processing) |
| Ethnic Origin: | Filipino |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Van de Water N, Tan T, Crowley M, Kerr R, Browett P, Novel α-Globin Splice Site Mutation (HBA2: c.96-5C>A) in Combination with Three-Gene Deletion Hb H Disease., Hemoglobin, 42(2), 122-125, 2018