IthaID: 3358


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2297339 HGVS Name: NG_012002.1:g.5046C>T

Context nucleotide sequence:
CCTGCGCAAGCGCGACGTCTTAGCT [A/G] TGCACCGCGCGACGGCAATGCCTCA (Strand: +)

Also known as:  C32T, -162C>T

Comments: C32T of HBS1L exon 1 is a putative E-box motif. The C allele associated with elevated HbF levels among Thai-Chinese β0-thalassaemia/Hb E patients with Gγ-globin XmnI (-/-) and XmnI (+/-) polymorphisms.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 6
Locus: NG_012002.1
Locus Location: 5046
Size: 1 bp
Located at: HBS1L
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: 5'UTR (Transcription)
Ethnic Origin: Thai-Chinese
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Pandit RA, Svasti S, Sripichai O, Munkongdee T, Triwitayakorn K, Winichagoon P, Fucharoen S, Peerapittayamongkol C, Association of SNP in exon 1 of HBS1L with hemoglobin F level in beta0-thalassemia/hemoglobin E., Int. J. Hematol. , 88(4), 357-61, 2008
Created on 2019-03-27 13:48:03, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.