IthaID: 3338
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs3024997 | HGVS Name: | NG_008732.1:g.12155G>A |
Context nucleotide sequence:
GATTTTGGAAGGACTTGCCTGATTC [A/G] GAAGCTCCAAAGAGTGGCATTACAG (Strand: +)
Also known as:
Comments: SNP (G>A) was found to be strongly associated with low HbF levels and the severe phenotype of β-thalassaemia major.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
Chromosome: | 6 |
---|---|
Locus: | NG_008732.1 |
Locus Location: | 12155 |
Size: | 1 bp |
Located at: | VEGFA |
Specific Location: | Intron 2 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Greek |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Chondrou V, Kolovos P, Sgourou A, Kourakli A, Pavlidaki A, Kastrinou V, John A, Symeonidis A, Ali BR, Papachatzopoulou A, Katsila T, Patrinos GP, Whole transcriptome analysis of human erythropoietic cells during ontogenesis suggests a role of VEGFA gene as modulator of fetal hemoglobin and pharmacogenomic biomarker of treatment response to hydroxyurea in β-type hemoglobinopathy patients., Hum. Genomics , 11(1), 24, 2017
Created on 2018-06-25 17:07:43,
Last reviewed on 2019-05-20 16:07:21 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2018-06-25 17:07:43 | The IthaGenes Curation Team | Created |
2 | 2019-05-20 16:07:21 | The IthaGenes Curation Team | Reviewed. Mutation comment updated. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-24 11:43:02