IthaID: 3338


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs3024997 HGVS Name: NG_008732.1:g.12155G>A

Context nucleotide sequence:
GATTTTGGAAGGACTTGCCTGATTC [A/G] GAAGCTCCAAAGAGTGGCATTACAG (Strand: +)

Also known as:

Comments: SNP (G>A) was found to be strongly associated with low HbF levels and the severe phenotype of β-thalassaemia major.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 6
Locus: NG_008732.1
Locus Location: 12155
Size: 1 bp
Located at: VEGFA
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Greek
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Chondrou V, Kolovos P, Sgourou A, Kourakli A, Pavlidaki A, Kastrinou V, John A, Symeonidis A, Ali BR, Papachatzopoulou A, Katsila T, Patrinos GP, Whole transcriptome analysis of human erythropoietic cells during ontogenesis suggests a role of VEGFA gene as modulator of fetal hemoglobin and pharmacogenomic biomarker of treatment response to hydroxyurea in β-type hemoglobinopathy patients., Hum. Genomics , 11(1), 24, 2017
Created on 2018-06-25 17:07:43, Last reviewed on 2019-05-20 16:07:21 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.