IthaID: 3337
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs6920211 | HGVS Name: | NC_000006.12:g.135110180T>C |
Context nucleotide sequence:
GGTTCCATTGAGACTGATGCTGCAT [C/T] GAATTCTGATGATACAGTTCGCTGC (Strand: +)
Also known as:
Comments: SNP is located within an enhancer-like regulatory sequence 71 kb upstream of the MYB transcriptional start site (-71 LDB1 complex binding site) [PMID: 24614105]. rs6920211 (C) associated with elevated HbF levels in a Nigerian cohort with sickle cell disease [PMID: 29879141].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 6 |
|---|---|
| Locus: | NT_025741.15 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | HBS1L-MYB |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Nigerian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Stadhouders R, Aktuna S, Thongjuea S, Aghajanirefah A, Pourfarzad F, van Ijcken W, Lenhard B, Rooks H, Best S, Menzel S, Grosveld F, Thein SL, Soler E, HBS1L-MYB intergenic variants modulate fetal hemoglobin via long-range MYB enhancers., J. Clin. Invest. , 124(4), 1699-710, 2014
- Adeyemo TA, Ojewunmi OO, Oyetunji IA, Rooks H, Rees DC, Akinsulie AO, Akanmu AS, Thein SL, Menzel S, A survey of genetic fetal-haemoglobin modifiers in Nigerian patients with sickle cell anaemia., PLoS ONE , 13(6), e0197927, 2018
Created on 2018-06-20 17:32:50,
Last reviewed on 2019-05-22 16:20:37 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.