
IthaID: 3332
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs4025935 | HGVS Name: | NG_009246.1:g.4023_4024delTG |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AAGGTATATATGCTCTGGAAAACTT [-/TG] TAATATTGAGTTGGTCTGGTGGTAA (Strand: +)
Comments: The GSTM1 null genotype (rs4025935) associated with HbA1 and HbS levels in sickle cell disease patients from Saudi Arabia [PMID: 27885941]. It is a predisposing factor for cardiac iron overload in β-thalassaemia major patients with low body iron as assessed by lifelong serum ferritin levels [PMID: 18477036]. It associated with significantly shorter cardiac MRI T2* values (hence, cardiac iron overload) independent of serum ferritin levels in Egyptian patients with β-thalassaemia major [PMID: 26288192].
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Cardiac iron load Anaemia [HP:0001903] |
Location
Chromosome: | 1 |
---|---|
Locus: | NG_009246.1 |
Locus Location: | 4023 |
Size: | 2 bp |
Located at: | GSTM1 |
Specific Location: | 5'UTR |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Saudi, Egyptian, Sardinian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Origa R, Satta S, Matta G, Galanello R, Glutathione S-transferase gene polymorphism and cardiac iron overload in thalassaemia major., Br. J. Haematol. , 142(1), 143-5, 2008
- Mokhtar GM, Sherif EM, Habeeb NM, Abdelmaksoud AA, El-Ghoroury EA, Ibrahim AS, Hamed EM, Glutathione S-transferase gene polymorphism: Relation to cardiac iron overload in Egyptian patients with Beta Thalassemia Major., Hematology , 21(1), 46-53, 2016
- Abu-Duhier F, Mir R, GSTT1 (rs4025935) null genotype is associated with increased risk of sickle cell disease in the populations of Tabuk-Northwestern region of Saudi Arabia., Hematology , 2016