IthaID: 3326

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 73 GTG>G-G HGVS Name: HBA1:c.221delT
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTGACCAACGCCGTGGCGCACG [T/-] GGACGACATGCCCAACGCGCTGTCCGC (Strand: +)

Comments: The case was referred as a Hb S carrier. Haematology/biochemistry analyses showed red cell indices typical of Hb S heterozygosity, with Hb S 32.2%. Protein stability and oxygen affinity were not tested.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37917
Size: 1 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Greek
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Traeger Synodinos, Jan2018-03-28First report.
2Fylaktou, Eirini2018-03-28First report.
Created on 2018-03-31 14:30:03, Last reviewed on 2018-04-02 10:10:23 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.