IthaID: 3306
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 25/26 -GTG [-Gly] | HGVS Name: | HBB:c.77_79delGTG |
| Hb Name: | Hb M Dothan | Protein Info: | β 25(B7) - 26(B8) Gly-Glu->0 AND inserted Glu |
Context nucleotide sequence:
CAAGGTGAACGTGGATGAAGTTGGTG [-/GTG] AGGCCCTGGGCAGGTTGGTATCAA (Strand: -)
Also known as: Hb Higashitochigi, Hb HT
Comments: Hb M-Dothan associates with the methemoglobin (Met-Hb) phenotype due to a 3 bp deletion causing a single amino acid [-Gly] deletion in the B-helix (B7/B8) of the β globin chain. The in-frame deletion disrupts the close spatial relation between the helical segments B and E and, as a result, indirectly distorts the heme pocket on the E-helix. Found in a young Japanese boy and a 9-months American boy, both presenting with cyanosis.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | Methemoglobinaemia |
| Stability: | Unstable |
| Oxygen Affinity: | Decreased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70671 |
| Size: | 3 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Japanese, American |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Fujisawa K, Yamashiro Y, Hattori Y, Ohha Y, Kajita T, Kageyama S, Arita J, Hb Higashitochigi (Hb Ht) [ beta 24(B6) or beta 25(B7) glycine deleted]: a new unstable variant expressing cyanosis., Hemoglobin, 17(5), 467-73, 1993
- Kutlar F, Hilliard LM, Zhuang L, Patel N, Eroglu B, Meiler SE, Carmichael H, Russell RB, Kutlar A, Hb M Dothan [beta 25/26 (B7/B8)/(GGT/GAG-->GAG//Gly/Glu-->Glu]; a new mechanism of unstable methemoglobin variant and molecular characteristics., Blood Cells Mol. Dis. , 43(3), 235-8, 2009
Created on 2018-02-06 17:23:02,
Last reviewed on 2024-03-07 11:08:32 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.