IthaID: 3302
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | 3'UTR +46 C>A | HGVS Name: | HBA1:c.*46C>A |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GCTTCTTGCCCCTTGGGCCTCCCCC [C/A] AGCCCCTCCTCCCCTTCCTGCACCC (Strand: +)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 38320 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Lacerra G, Fiorito M, Musollino G, Di Noce F, Esposito M, Nigro V, Gaudiano C, Carestia C, Sequence variations of the alpha-globin genes: scanning of high CG content genes with DHPLC and DG-DGGE., Hum. Mutat. , 24(4), 338-49, 2004
- Ropero P, González FA, Nieto JM, Villegas A, Sevilla J, Pérez G, Alonso JM, Recasens V, Abio M, Vagace JM, Vanegas RJ, González Fernández B, Martínez R, C>A substitution in NT 46 of the 3' UTR region (the α complex protected region) of the alpha-1 globin gene: a non-deletional mutation or polymorphism?, J. Clin. Pathol., 73(1), 14-16, 2020
Created on 2018-01-30 19:12:40,
Last reviewed on 2022-10-21 08:58:28 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.