IthaID: 3302

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Benign / Likely Benign
Common Name:	3'UTR +46 C>A	HGVS Name:	HBA1:c.*46C>A
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
GCTTCTTGCCCCTTGGGCCTCCCCC [C/A] AGCCCCTCCTCCCCTTCCTGCACCC (Strand: +)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	α-thalassaemia
Allele Phenotype:	N/A
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	16
Locus:	NG_000006.1
Locus Location:	38320
Size:	1 bp
Located at:	α1
Specific Location:	3'UTR

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Other 3'UTR site (mRNA Processing)
Ethnic Origin:	N/A
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Lacerra G, Fiorito M, Musollino G, Di Noce F, Esposito M, Nigro V, Gaudiano C, Carestia C, Sequence variations of the alpha-globin genes: scanning of high CG content genes with DHPLC and DG-DGGE., Hum. Mutat. , 24(4), 338-49, 2004
Ropero P, González FA, Nieto JM, Villegas A, Sevilla J, Pérez G, Alonso JM, Recasens V, Abio M, Vagace JM, Vanegas RJ, González Fernández B, Martínez R, C>A substitution in NT 46 of the 3' UTR region (the α complex protected region) of the alpha-1 globin gene: a non-deletional mutation or polymorphism?, J. Clin. Pathol., 73(1), 14-16, 2020

Created on 2018-01-30 19:12:40, Last reviewed on 2022-10-21 08:58:28 (Show full history)

A/A	Date	Curator(s)	Comments
1	2018-01-30 19:12:40	The IthaGenes Curation Team	Created
2	2018-01-31 16:48:02	The IthaGenes Curation Team	Reviewed. Mutation synonym name removed.
3	2020-01-17 12:02:46	The IthaGenes Curation Team	Reviewed. Reference added.
4	2021-05-26 10:02:14	The IthaGenes Curation Team	Reviewed. HGVS name corrected. Effect on gene added.
5	2022-10-21 08:58:28	The IthaGenes Curation Team	Reviewed. Functionality changed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.