IthaID: 3301


Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: Benign / Likely Benign
Common Name: TTS +26 A>G HGVS Name: HBA2:c.*136A>G

Context nucleotide sequence:
GCCTGTGTGTGCCTGGGTTCTCTCT [A/G] TCCCGGAATGTGCCAACAATGGAGG (Strand: +)

Also known as:

Comments: The location of this substitution is 48 nucleotides relative to poly A signal (+861 G>A).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34599
Size: 1 bp
Located at: α2
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Turkish, South Italian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Lacerra G, Fiorito M, Musollino G, Di Noce F, Esposito M, Nigro V, Gaudiano C, Carestia C, Sequence variations of the alpha-globin genes: scanning of high CG content genes with DHPLC and DG-DGGE., Hum. Mutat. , 24(4), 338-49, 2004
  2. Lacerra G, Musollino G, Di Noce F, Prezioso R, Carestia C, Genotyping for known Mediterranean alpha-thalassemia point mutations using a multiplex amplification refractory mutation system., Haematologica , 92(2), 254-5, 2007
  3. Cardiero G, Musollino G, Friscia MG, Testa R, Virruso L, Di Girgenti C, Caldora M, Colella Bisogno R, Gaudiano C, Manco G, Lacerra G, Effect of Mutations on mRNA and Globin Stability: The Cases of Hb Bernalda/Groene Hart and Hb Southern Italy., Genes (Basel), 11(8), , 2020
Created on 2018-01-30 18:36:41, Last reviewed on 2021-05-26 10:19:21 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.