IthaID: 33

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	-22 to +23 (+45 bp duplication)	HGVS Name:	NG_000007.3:g.70573_70617dup
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
ACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGA [-/CTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGA] GAAGTCTGCCGTTACT (Strand: -)

Also known as:

Comments: The variant is a duplication of a region of 45 nucleotides from -22 to +23 of the HBB cDNA (coordinates: GRCh38.p13, NC_000011.10). This region includes the start codon encoding two open reading frames. Therefore, transcription from the original initiation codon produces an irrelevant seven-residue peptide, while residual translation from the novel initiation codon results in diminished protein of b-globin.

External Links

LOVD

ClinVar

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70573
Size:	45 bp
Located at:	β

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	β+
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation:	Duplication
Ethnic Origin:	Maori
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

Publications / Origin

Blacklock HA, Case J, Chan T, Raizis T, Doocey R, Fellowes A, Royle G, Jackson S, Brennan S, George P, Novel sequence insertion in a Mâori patient with transfusion-dependent beta-thalassaemia., British journal of haematology, 131(3), 400-2, 2005

Created on 2010-06-16 16:13:14, Last reviewed on 2020-04-13 16:04:49 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:14	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2020-04-12 19:29:52	The IthaGenes Curation Team	Reviewed. HGVS name, common name, Chromosome and Locus location corrected. Comment, allele and context sequence added.
4	2020-04-13 15:47:37	The IthaGenes Curation Team	Reviewed. HGVS name corrected.
5	2020-04-13 16:04:49	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.