IthaID: 3299


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 77/78 (+C) HGVS Name: HBB:c.235dupC
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CCTTTAGTGATGGCCTGGCTCACC [-/C] TGGACAACCTCAAGGGCACCTTTG (Strand: -)

Also known as:

Comments: Found as a heterozygote. This mutation causes an insertion in the normal reading frame of the β-globin coding sequence and a new stop codon at β90, resulting in premature arrest of protein synthesis.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70959
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Bangladeshi
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Frequencies

Publications / Origin

  1. Aziz A, Das SA, Khan WA, Sadiya S, Banu B, Sarwardi G, Luna RZ, A Novel β-Thalassemia Insertion/Frameshift Mutation Between Codons 77/78 (p.Leu78Profs*13 or HBB: c.235_236insC) Observed in a Family in Bangladesh., Hemoglobin , 41(4), 311-313, 2017
Created on 2018-01-22 19:32:01, Last reviewed on 2019-11-12 16:38:45 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.