IthaID: 3299
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 77/78 (+C) | HGVS Name: | HBB:c.235dupC |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CCTTTAGTGATGGCCTGGCTCACC [-/C] TGGACAACCTCAAGGGCACCTTTG (Strand: -)
Also known as:
Comments: Found as a heterozygote. This mutation causes an insertion in the normal reading frame of the β-globin coding sequence and a new stop codon at β90, resulting in premature arrest of protein synthesis.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70959 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Bangladeshi |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Aziz A, Das SA, Khan WA, Sadiya S, Banu B, Sarwardi G, Luna RZ, A Novel β-Thalassemia Insertion/Frameshift Mutation Between Codons 77/78 (p.Leu78Profs*13 or HBB: c.235_236insC) Observed in a Family in Bangladesh., Hemoglobin , 41(4), 311-313, 2017
Created on 2018-01-22 19:32:01,
Last reviewed on 2019-11-12 16:38:45 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.