IthaID: 3297
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 11-13 (-9bp): (-GTTACTGCC) | HGVS Name: | HBB:c.34_42delGTTACTGCC |
| Hb Name: | Hb JC-Paz | Protein Info: | N/A |
Context nucleotide sequence:
TCTGACTCCTGAGGAGAAGTCTGCC [-/GTTACTGCC] CTGTGGGGCAAGGTGAACGTGGATGAA (Strand: -)
Also known as:
Comments: Found as a heterozygote. The deletion results in loss of an alanine, a valine and a threonine of the 'A' α-helix of the β-globin chain. Reported in the literature as HBB:c.29_37delCTGCCGTTA, which does not follow the HGVS Sequence Variant Nomeclature recommendations.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70628 |
| Size: | 9 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | Argentinean |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Scheps KG, Hasenahuer MA, Parisi G, Targovnik HM, García E, Veber ES, Crisp R, Elena G, Varela V, Fornasari MS, Two novel unstable hemoglobin variants due to in-frame deletions of key amino acids in the β-globin chain., Eur. J. Haematol. , 2018
Created on 2018-01-22 18:28:48,
Last reviewed on 2019-11-08 12:29:56 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.