IthaID: 3290
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs3817621 | HGVS Name: | NG_013087.1:g.4813C>G |
Context nucleotide sequence:
AAGCCAAGTCAAATATCAAGGGTTG [C/G/T] GGGGTTCAGGGTTTGAGGGTCCAGG (Strand: +)
Also known as: -251 C>G
Comments: SNP associated with elevated HbF levels in severely affected Thai β0‑thalassemia/HbE patients.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 19 |
|---|---|
| Locus: | NG_013087.1 |
| Locus Location: | 4813 |
| Size: | 1 bp |
| Located at: | KLF1 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Thai |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Khamphikham P, Sripichai O, Munkongdee T, Fucharoen S, Tongsima S, Smith DR, Genetic variation of Krüppel-like factor 1 (KLF1) and fetal hemoglobin (HbF) levels in β0-thalassemia/HbE disease., Int. J. Hematol. , 2017
Created on 2018-01-08 17:24:53,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.