
IthaID: 3269
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 147 TGA>CGA [Stop>Arg] | HGVS Name: | HBD:c.442T>C |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCCCTGGCTCACAAGTACCAT [T>C] GAGATCCTGGACTGTTTCCTG (Strand: -)
Comments: The mutation results in the synthesis of a longer polypeptide by 15 amino acids before the new stop codon is reached. Possibly removed by mechanisms for the degradation of aberrant proteins. Detected in a molecular diagnostics laboratory in Italy.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | δ-thalassaemia |
| Allele Phenotype: | δ0 |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 64650 |
| Size: | 1 bp |
| Located at: | δ |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Italian, Tunisian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Cassarà F, Vinciguerra M, Cannata M, Marchese G, Passarello C, Leto F, Maggio A, Giambona A, Phenotypic Evaluation of a Novel Nucleotide Substitution (HBD: c.442T>C) on the δ-Globin Gene., Hemoglobin , 41(3), 220-222, 2017
- Di Bella C, Pugliatti F, La Rosa MA, Cara S, Capra AP, Rigoli L, A Novel Mutation of the δ-Globin Gene in an Asymptomatic 30-Year-Old Female., Acta Haematol., 139(1), 33-34, 2018
- Kasmi C, Amri Y, Hadj-Fredj S, Oueslati S, Dabboussi M, Mahjoub R, Hammami S, Aljane I, Mami FB, Jamoussi H, Messaoud T, Bibi A, Analysis of δ-globin gene alleles in Tunisians: description of three new delta-thalassemia mutations., Mol Biol Rep, 48(8), 5923-5933, 2021
Created on 2017-10-02 18:50:57,
Last reviewed on 2021-10-12 12:14:46 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.