IthaID: 3263
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs35685045 | HGVS Name: | NG_012649.1:g.90541C>T |
Context nucleotide sequence:
TATTTTACATGCTATAAAAATCACC [C/T] TTTTAAAAGGTACAATTCAGGCCAG (Strand: +)
Also known as:
Comments: SNP associated with HbF in cohorts of Saudi AI haplotype HbS homozygotes. This SNP is in perfect linkage disequilibrium (LD) with rs4527238.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_012649.1 |
| Locus Location: | 90541 |
| Size: | 1 bp |
| Located at: | ANTXR1 |
| Specific Location: | Intron 9 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Saudi |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Vathipadiekal V, Farrell JJ, Wang S, Edward HL, Shappell H, Al-Rubaish AM, Al-Muhanna F, Naserullah Z, Alsuliman A, Qutub HO, Simkin I, Farrer LA, Jiang Z, Luo HY, Huang S, Mostoslavsky G, Murphy GJ, Patra PK, Chui DH, Alsultan A, Al-Ali AK, Sebastiani P, Steinberg MH, A candidate transacting modulator of fetal hemoglobin gene expression in the Arab-Indian haplotype of sickle cell anemia., Am. J. Hematol. , 91(11), 1118-1122, 2016
- Habara AH, Shaikho EM, Steinberg MH, Fetal hemoglobin in sickle cell anemia: The Arab-Indian haplotype and new therapeutic agents., Am. J. Hematol. , 2017
Created on 2017-09-26 17:28:23,
Last reviewed on 2020-02-19 15:13:05 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.