IthaID: 3259
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs2333227 | HGVS Name: | NG_009629.1:g.4535G>A |
Context nucleotide sequence:
AGCACTTTGGGAGGCTGAGGC [G>A] GGTGGATCACTTGAGGTCAGG (Strand: -)
Also known as: -463G>A
Comments: Association with increased susceptibility to infections in a cohort of SCA children, suggesting a deleterious effect [PMID: 15996936]. Association with enhanced oxidative stress (higher AOPP levels) and with a delayed age of first complication in an independent cohort of SCA, which would rather suggest a protective effect [PMID: 32937882]. Association with lipid (i.e. total cholesterol and low-density lipoprotein cholesterol (LDL-C)) laboratory markers in SCA patients treated with hydroxyurea. Association with hepatic (i.e. globulin), inflammation (i.e. uric acid) and lipid/glycemic (i.e. glucose) laboratory markers in SCA patients not treated with hydroxyurea [PMID: 29619129].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Recurrent infections [HP:0002719] |
Location
| Chromosome: | 17 |
|---|---|
| Locus: | NG_009629.1 |
| Locus Location: | 4535 |
| Size: | 1 bp |
| Located at: | MPO |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Brazilian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Costa RN, Conran N, Albuquerque DM, Soares PH, Saad ST, Costa FF, Association of the G-463A myeloperoxidase polymorphism with infection in sickle cell anemia., Haematologica , 90(7), 977-9, 2005
- Yahouédéhou SCMA, Carvalho MOS, Oliveira RM, Santiago RP, da Guarda CC, Carvalho SP, Ferreira JRD, Aleluia MM, Adorno EV, Gonçalves MS, Sickle Cell Anemia Patients in Use of Hydroxyurea: Association between Polymorphisms in Genes Encoding Metabolizing Drug Enzymes and Laboratory Parameters., Dis. Markers, 2018(0), 6105691, 2018
- Gueye Tall F, Martin C, Ndour EHM, Faes C, Déme Ly I, Pialoux V, Connes P, Gueye PM, Ndiaye Diallo R, Renoux C, Diagne I, Diop PA, Cissé A, Sall PL, Joly P, Influence of Oxidative Stress Biomarkers and Genetic Polymorphisms on the Clinical Severity of Hydroxyurea-Free Senegalese Children with Sickle Cell Anemia., Antioxidants (Basel), 9(9), 0, 2020