IthaID: 3245


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs4696480 HGVS Name: NG_016229.1:g.6686T>A

Context nucleotide sequence:
TCCAAGATTGAAGGGCTGCATCTGG [A/T] GAGGGTCATCTGGCTACATTATAAC (Strand: +)

Also known as:

Comments: SNP associated with occurrence of infections in patients with sickle cell disease. The TA genotype associated with susceptibility to bacterial infections in a paediatric cohort [PMID: 28667380], but was protective against infections in an adult cohort [PMID: 30908604].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Recurrent respiratory infections [HP:002205]

Location

Chromosome: 4
Locus: NG_016229.1
Locus Location: 6686
Size: 1 bp
Located at: TLR2
Specific Location: Promoter 0

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Brazilian, Sub-Saharan African, French West Indies, North African, Indian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. David S, Aguiar P, Antunes L, Dias A, Morais A, Sakuntabhai A, Lavinha J, Variants in the non-coding region of the TLR2 gene associated with infectious subphenotypes in pediatric sickle cell anemia., Immunogenetics , 2017
  2. Tozatto-Maio K, Girot R, Ly ID, Rocha V, Silva Pinto AC, Diagne I, Benzerara Y, Dinardo CL, Kashima S, Leston-Araujo I, Kenzey C, Fonseca GHH, Rodrigues ES, Volt F, Jarduli LR, Ruggeri A, Mariaselvam CM, Gualandro SFM, Elayoubi H, Cunha R, Cappelli B, Malmegrim KCR, Simões BP, Gluckman E, Tamouza R, A Toll-like receptor 2 genetic variant modulates occurrence of bacterial infections in patients with sickle cell disease., Br. J. Haematol., 2019
Created on 2017-07-24 14:08:45, Last reviewed on 2019-12-23 15:10:20 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.