IthaID: 3231


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 7 (-3bp): (-GAG) HGVS Name: HBD:c.22_24delGAG
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TGGTGCATCTGACTCCTGAG [GAG/-] AAGACTGCTGTCAATGCCCT (Strand: +)

Also known as:

Comments: Found in one case after haematological and mutation spectrum analysis of δ-globin gene in Chinese Han prenatal population [PMID: 28592066]. One additional case was reported in a 41-year-old Chinese male presented with normal haematological indices.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: δ-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 63204
Size: 3 bp
Located at: δ
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Chinese Han
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Zhong LY, Xie YJ, Chen PS, Feng YW, Liu M, Huang B, He XH, Gan X, [Analysis of haematological phenotype and mutation spectrum of δ-globin gene from Guangdong area in Chinese Han prenatal population]., Zhonghua Yi Xue Za Zhi , 97(20), 1580-1583, 2017

Microattributions

A/AContributor(s)DateComments
1Li, Youqiong2021-04-12Report of an update.
Created on 2017-07-11 15:48:01, Last reviewed on 2022-09-15 11:55:23 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.