IthaID: 3227

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 125-126 (+CCAGT) HGVS Name: HBB:c.376_380dupCCAGT
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGGCAAAGAATTCACCCCACCAGT [-/CCAGT] GCAGGCTGCCTATCAGAAAGTGG (Strand: -)

Comments: Found as a heterozygote with a thalassemia intermedia phenotype and a dominant transmission pattern. Frameshift mutation that creates a novel transcription termination site at position 159 (vs. native stop codon at position 147), generating a slightly longer protein with unnatural C-terminus. The mutant version of mRNA was not detectable.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71950
Size: 5 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Polish
Molecular mechanism: Altered α1β1 interface
Inheritance: Dominant
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Rawa K, Szczesny RJ, Owczarek EP, Adamowicz-Salach A, Klukowska A, Demkow U, Plochocka D, Szczesny P, Gora M, Dziembowski A, Burzynska B, Two novel C-terminal frameshift mutations in the β-globin gene lead to rapid mRNA decay., BMC Med. Genet. , 18(1), 65, 2017
Created on 2017-07-11 13:18:22, Last reviewed on 2019-11-12 15:14:57 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.