IthaID: 3206


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs71785313 HGVS Name: NG_023228.1:g.17930_17935delTTATAA

Context nucleotide sequence:
GAGGAGAAGCTAAACATTCTCAACA [-/TTATAA] ATAAGATTCTGCAGGCGGACCAAGA (Strand: +)

Also known as: APOL1 G2

Comments: SNP associated with protection against albuminuria in sickle cell disease (SCD) pediatric cohorts acquired from the HUSTLE (Hydroxyurea Study of Long-termEffects) and TWiTCH (TCD With Transfusions Changing to Hydroxyurea) clinical trials [PMID: 27711207]. SNP (APOL1 G2/G2 or G1/G2 genotypes) associated with a higher risk of end-stage renal disease, as well as with albuminuria, proteinuria and a lower estimated glomerular filtration rate (eGFR) in SCD adult patients of Sub-Saharan ancestry [PMID: 28699644].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Abnormal GFR [HP:0012212]
Proteinuria [HP:0000093]
Albuminuria [HP:0012592]

Location

Chromosome: 22
Locus: NG_023228.1
Locus Location: 17930
Size: 6 bp
Located at: APOL1
Specific Location: Exon 7

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Schaefer BA, Flanagan JM, Alvarez OA, Nelson SC, Aygun B, Nottage KA, George A, Roberts CW, Piccone CM, Howard TA, Davis BR, Ware RE, Genetic Modifiers of White Blood Cell Count, Albuminuria and Glomerular Filtration Rate in Children with Sickle Cell Anemia., PLoS ONE , 11(10), e0164364, 2016
  2. Kormann R, Jannot AS, Narjoz C, Ribeil JA, Manceau S, Delville M, Joste V, Prié D, Pouchot J, Thervet E, Courbebaisse M, Arlet JB, Roles of APOL1 G1 and G2 variants in sickle cell disease patients: kidney is the main target., Br. J. Haematol. , 2017
Created on 2017-03-13 16:28:16, Last reviewed on 2017-08-21 14:37:01 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.