IthaID: 3206
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs71785313 | HGVS Name: | NG_023228.1:g.17930_17935delTTATAA |
Context nucleotide sequence:
GAGGAGAAGCTAAACATTCTCAACA [-/TTATAA] ATAAGATTCTGCAGGCGGACCAAGA (Strand: +)
Also known as: APOL1 G2
Comments: SNP associated with protection against albuminuria in sickle cell disease (SCD) pediatric cohorts acquired from the HUSTLE (Hydroxyurea Study of Long-termEffects) and TWiTCH (TCD With Transfusions Changing to Hydroxyurea) clinical trials [PMID: 27711207]. SNP (APOL1 G2/G2 or G1/G2 genotypes) associated with a higher risk of end-stage renal disease, as well as with albuminuria, proteinuria and a lower estimated glomerular filtration rate (eGFR) in SCD adult patients of Sub-Saharan ancestry [PMID: 28699644].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Abnormal GFR [HP:0012212] Proteinuria [HP:0000093] Albuminuria [HP:0012592] |
Location
| Chromosome: | 22 |
|---|---|
| Locus: | NG_023228.1 |
| Locus Location: | 17930 |
| Size: | 6 bp |
| Located at: | APOL1 |
| Specific Location: | Exon 7 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Schaefer BA, Flanagan JM, Alvarez OA, Nelson SC, Aygun B, Nottage KA, George A, Roberts CW, Piccone CM, Howard TA, Davis BR, Ware RE, Genetic Modifiers of White Blood Cell Count, Albuminuria and Glomerular Filtration Rate in Children with Sickle Cell Anemia., PLoS ONE , 11(10), e0164364, 2016
- Kormann R, Jannot AS, Narjoz C, Ribeil JA, Manceau S, Delville M, Joste V, Prié D, Pouchot J, Thervet E, Courbebaisse M, Arlet JB, Roles of APOL1 G1 and G2 variants in sickle cell disease patients: kidney is the main target., Br. J. Haematol. , 2017