IthaID: 3205
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs2814778 | HGVS Name: | NG_011626.2:g.5174T>C |
Context nucleotide sequence:
GGCTGTCAGCGCCTGTGCTTCCAAG [A/G] TAAGAGCCAAGGACTAATGAGGGCC (Strand: -)
Also known as:
Comments: SNP associated with white blood cell (WBC) and absolute neutrophil count (ANC) levels in SCA pediatric cohorts acquired from the HUSTLE (Hydroxyurea Study of Long-termEffects), SWiTCH (StrokeWith Transfusions Changing to Hydroxyurea) and TWiTCH (TCDWith Transfusions Changing to Hydroxyurea) clinical trials. It also associated with a small protective effect against albuminuria in participants from the HUSTLE and TWiTCH studies.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Abnormal neutrophil cell number [HP:0011991] Abnormal white blood cell count [HP:0011893] Albuminuria [HP:0012592] |
Location
Chromosome: | 1 |
---|---|
Locus: | NG_011626.1 |
Locus Location: | 5174 |
Size: | 1 bp |
Located at: | ACKR1 |
Specific Location: | 5'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | 5'UTR (Transcription) |
Ethnic Origin: | N/A |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Schaefer BA, Flanagan JM, Alvarez OA, Nelson SC, Aygun B, Nottage KA, George A, Roberts CW, Piccone CM, Howard TA, Davis BR, Ware RE, Genetic Modifiers of White Blood Cell Count, Albuminuria and Glomerular Filtration Rate in Children with Sickle Cell Anemia., PLoS ONE , 11(10), e0164364, 2016
Created on 2017-03-13 15:08:12,
Last reviewed on 2017-03-13 16:21:59 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2017-03-13 15:08:12 | The IthaGenes Curation Team | Created |
2 | 2017-03-13 15:09:36 | The IthaGenes Curation Team | Reviewed. |
3 | 2017-03-13 16:21:59 | The IthaGenes Curation Team | Reviewed. Clinical phenotype section updated. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07