IthaID: 3204


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1801704 HGVS Name: NG_016421.1:g.5220C>T

Context nucleotide sequence:
CTGAGGCGCCCCCAGCCAGTGCGCT [C/T] ACCTGCCAGACTGCGCGCCATGGGG (Strand: +)

Also known as:

Comments: SNP associated with chronic pain in sickle cell disease. SNP was found to be in a linkage disequilibrium block in the studied cohort.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Pain [HP:0012531]

Location

Chromosome: 5
Locus: NG_016421.1
Locus Location: 5220
Size: 1 bp
Located at: ADRB2
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Jhun E, He Y, Yao Y, Wilkie D, Molokie R, Wang J, (283) Beta2-adrenergic receptor gene polymorphisms and haplotypes associate with chronic pain in sickle cell disease., J Pain , 17(4), S46-S47, 2016
Created on 2017-02-28 13:29:44, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.