IthaID: 3203
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1042711 | HGVS Name: | NG_016421.1:g.5193C>T |
Context nucleotide sequence:
CGCAGAGCCCCGCCGTGGGTCCGCC [C/T] GCTGAGGCGCCCCCAGCCAGTGCGC (Strand: +)
Also known as:
Comments: SNP associated with chronic pain in sickle cell disease. SNP was found to be in a linkage disequilibrium block in the studied cohort.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Pain [HP:0012531] |
Location
| Chromosome: | 5 |
|---|---|
| Locus: | NG_016421.1 |
| Locus Location: | 5193 |
| Size: | 1 bp |
| Located at: | ADRB2 |
| Specific Location: | 5'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Jhun E, He Y, Yao Y, Wilkie D, Molokie R, Wang J, (283) Beta2-adrenergic receptor gene polymorphisms and haplotypes associate with chronic pain in sickle cell disease., J Pain , 17(4), S46-S47, 2016
Created on 2017-02-28 13:25:34,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.