IthaID: 3196
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1478605 | HGVS Name: | NC_000015.10:g.39581083G>A |
Context nucleotide sequence:
AACTCGCAGGCCAGCTCGGGCGCAG [C/T] GGCTGGCAAGGCGGAGGAGCCGCGC (Strand: -)
Also known as:
Comments: SNP associated with variation in pulmonary artery systolic pressure in individuals with sickle cell disease from the multicenter walk-PHaSST trial (Treatment of Pulmonary Hypertension and Sickle Cell Disease with Sildenafil Therapy).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Pulmonary arterial hypertension [HP:0002092] [OMIM:265400] |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Jacob SA, Novelli EM, Isenberg JS, Garrett ME, Chu Y, Soldano K, Ataga KI, Telen MJ, Ashley-Koch A, Gladwin MT, Zhang Y, Kato GJ, Thrombospondin-1 gene polymorphism is associated with estimated pulmonary artery pressure in patients with sickle cell anemia., Am. J. Hematol. , 92(3), E31-E34, 2017
Created on 2017-02-21 14:44:50,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.