IthaID: 3191


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs11036338 HGVS Name: NG_000007.3:g.76148C>G

Context nucleotide sequence:
AGGCAGTCTGCCTGTTCTCAGATCT [C/G] AAGCTATGTGCTGGGAGAACCACTA (Strand: +)

Also known as:

Comments: SNP associated with HbA2 levels in individuals from the SardiNIA study.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Anaemia [HP:0001903]

Location

Chromosome: 11
Locus:
Locus Location: 76148
Size: 1 bp
Located at: OR51V1-HBB
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Sardinian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Created on 2017-02-20 16:53:19, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.