IthaID: 3180


Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: Benign / Likely Benign
Common Name: 3'UTR +62 A>G HGVS Name: HBB:c.*62A>G

Context nucleotide sequence:
CCTTTGTTCCCTAAGTCCAACTACT [A/G] AACTGGGGGATATTATGAAGGGCC (Strand: -)

Also known as:

Comments: Found during a routine molecular analysis. Based on the normal hematology and clinical expression in the mother and child (both carriers for the novel single nucleotide variant), the mutation is likely non-pathogenic.

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72080
Size: 1 bp
Located at: β
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Other 3'UTR site (mRNA Processing)
Ethnic Origin: Middle East
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Traeger Synodinos, Jan2017-02-15First report.
Created on 2017-02-17 15:56:53, Last reviewed on 2021-05-26 09:49:23 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.