IthaID: 3180
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | 3'UTR +62 A>G | HGVS Name: | HBB:c.*62A>G |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CCTTTGTTCCCTAAGTCCAACTACT [A/G] AACTGGGGGATATTATGAAGGGCC (Strand: -)
Also known as:
Comments: Found during a routine molecular analysis. Based on the normal hematology and clinical expression in the mother and child (both carriers for the novel single nucleotide variant), the mutation is likely non-pathogenic.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72080 |
Size: | 1 bp |
Located at: | β |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
Ethnic Origin: | Middle East, Turkish |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Arpaci A, Gul BU, Ozcan O, Ilhan G, El C, Dirican E, Elmacioglu S, Kaya H, Presentation of two new mutations in the 3'untranslated region of the β-globin gene and evaluating the molecular spectrum of thalassemia mutations in the Mediterranean region of Turkey., Ann Hematol, 100(6), 1429-1438, 2021
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Traeger Synodinos, Jan | 2017-02-15 | First report. |
Created on 2017-02-17 15:56:53,
Last reviewed on 2022-07-13 10:33:54 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2017-02-17 15:56:53 | The IthaGenes Curation Team | Created |
2 | 2017-02-17 15:58:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2017-02-17 16:00:55 | The IthaGenes Curation Team | Reviewed. |
4 | 2020-09-28 16:54:21 | The IthaGenes Curation Team | Reviewed. Inheritance corrected. |
5 | 2021-05-26 09:45:56 | The IthaGenes Curation Team | Reviewed. HGVS and common name corrected. Links added. |
6 | 2021-05-26 09:49:23 | The IthaGenes Curation Team | Reviewed. Effect on gene added. |
7 | 2021-09-27 15:44:51 | The IthaGenes Curation Team | Reviewed. Origin and Reference added. |
8 | 2022-07-13 10:33:54 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07