IthaID: 3180

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Benign / Likely Benign
Common Name:	3'UTR +62 A>G	HGVS Name:	HBB:c.*62A>G
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
CCTTTGTTCCCTAAGTCCAACTACT [A/G] AACTGGGGGATATTATGAAGGGCC (Strand: -)

Also known as:

Comments: Found during a routine molecular analysis. Based on the normal hematology and clinical expression in the mother and child (both carriers for the novel single nucleotide variant), the mutation is likely non-pathogenic.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP	LOVD
ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	N/A
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	72080
Size:	1 bp
Located at:	β
Specific Location:	3'UTR

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Other 3'UTR site (mRNA Processing)
Ethnic Origin:	Middle East, Turkish
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Arpaci A, Gul BU, Ozcan O, Ilhan G, El C, Dirican E, Elmacioglu S, Kaya H, Presentation of two new mutations in the 3'untranslated region of the β-globin gene and evaluating the molecular spectrum of thalassemia mutations in the Mediterranean region of Turkey., Ann Hematol, 100(6), 1429-1438, 2021

Microattributions

A/A	Contributor(s)	Date	Comments
1	Traeger Synodinos, Jan	2017-02-15	First report.

Created on 2017-02-17 15:56:53, Last reviewed on 2022-07-13 10:33:54 (Show full history)

A/A	Date	Curator(s)	Comments
1	2017-02-17 15:56:53	The IthaGenes Curation Team	Created
2	2017-02-17 15:58:32	The IthaGenes Curation Team	Reviewed.
3	2017-02-17 16:00:55	The IthaGenes Curation Team	Reviewed.
4	2020-09-28 16:54:21	The IthaGenes Curation Team	Reviewed. Inheritance corrected.
5	2021-05-26 09:45:56	The IthaGenes Curation Team	Reviewed. HGVS and common name corrected. Links added.
6	2021-05-26 09:49:23	The IthaGenes Curation Team	Reviewed. Effect on gene added.
7	2021-09-27 15:44:51	The IthaGenes Curation Team	Reviewed. Origin and Reference added.
8	2022-07-13 10:33:54	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.