IthaID: 3177


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs3025020 HGVS Name: NG_008732.1:g.16158C>T

Context nucleotide sequence:
GCCTCTGGAGGGGAGCCCCCTATTC [C/T] GGCCCAACCCATGGCACCCACAGAG (Strand: +)

Also known as:

Comments: SNP associated with vaso-occlusive crisis in Bahraini with sickle cell anaemia.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Vaso-occlusive crisis

Location

Chromosome: 6
Locus: NG_008732.1
Locus Location: 16158
Size: 1 bp
Located at: VEGFA
Specific Location: Intron 6

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Bahraini
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Al-Habboubi HH, Mahdi N, Abu-Hijleh TM, Abu-Hijleh FM, Sater MS, Almawi WY, The relation of vascular endothelial growth factor (VEGF) gene polymorphisms on VEGF levels and the risk of vasoocclusive crisis in sickle cell disease., Eur. J. Haematol. , 89(5), 403-9, 2012
Created on 2017-02-14 14:39:06, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.