IthaID: 3174
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs7166737 | HGVS Name: | NC_000015.10:g.75390172A>G |
Context nucleotide sequence:
GGCTCCCCTGCTGAGAGAGGAACCT [A/G] CTCTCCCAGCCTGCACAAGAGCATT (Strand: +)
Also known as:
Comments: SNP associated with HbF response to treatment with hydroxyurea in β-thalassemia patients of Greek origin.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F response to hydroxyurea |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Greek |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Gravia A, Chondrou V, Kolliopoulou A, Kourakli A, John A, Symeonidis A, Ali BR, Sgourou A, Papachatzopoulou A, Katsila T, Patrinos GP, Correlation of SIN3A genomic variants with β-hemoglobinopathies disease severity and hydroxyurea treatment efficacy., Pharmacogenomics , 2016
Created on 2017-02-06 15:48:17,
Last reviewed on 2017-02-06 15:50:52 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.