IthaID: 3157


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs45496295 HGVS Name: NG_009617.1:g.6420G>A

Context nucleotide sequence:
GCCTGGAGGGGAAGGCACGGAGAGA [C/T] GGAGAGGTGAGGGCTGGCCAGGAGG (Strand: +)

Also known as:

Comments: SNP (T allele) associated with a lower transfusion regimen and a higher pre-transfusion Hb level in Tunisian patients with β-thalassaemia.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Anaemia [HP:0001903]

Location

Chromosome: 14
Locus: NG_009617.1
Locus Location: 6420
Size: 1 bp
Located at: CEBPE
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Tunisian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Mejri A, Mansri M, Hadj Fredj S, Ouali F, Bibi A, Hafsia R, Messaoud T, Siala H, First description of the rs45496295 polymorphism of the C/EBPE gene in β-thalassemia intermedia patients., Hemoglobin , 2016
Created on 2017-01-30 16:12:49, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.