IthaID: 3147
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | Init CD ATG>AAG [Met>Lys] | HGVS Name: | HBA1:c.2T>A |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CCCACAGACTCAGAGAGAACCCACCA [T>A] GGTGCTGTCTCCTGCCGACAAGAC (Strand: +)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37581 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Initiation codon (Translation) |
| Ethnic Origin: | Italian–Canadian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Waye JS, Eng B, Hanna M, Hohenadel BA, Nakamura L, Walker L, Novel Mutation of the Translation Initiation Codon of the α1-Globin Gene (ATG>AAG or HBA1:c.2T>A)., Hemoglobin , 40(5), 369-370, 2016
Created on 2017-01-24 10:55:39,
Last reviewed on 2018-02-27 18:11:30 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.