IthaID: 3146
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1800587 | HGVS Name: | NG_008850.1:g.5012C>T |
Context nucleotide sequence:
CTTTAATAATAGTAACCAGGCAACA [C/T] CATTGAAGGCTCATATGTAAAAATC (Strand: -)
Also known as:
Comments: SNP (T allele) associated with chronic pain in African-Americans with sickle cell disease.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Pain [HP:0012531] |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_008850.1 |
| Locus Location: | 5012 |
| Size: | 1 bp |
| Located at: | ILA1 |
| Specific Location: | 5'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Hu X, Jhun EH, Yao Y, He Y, Molokie RE, Wilkie DJ, Wang ZJ, IL1A rs1800587 associates with chronic noncrisis pain in sickle cell disease., Pharmacogenomics , 17(18), 1999-2006, 2016
- Hu X, Jhun E, Yao Y, He Y, Molokie R, Wilkie D, Wang Z, (280) Interleukin 1alpha rs1800587 associates with chronic non-crisis pain in sickle cell disease., J Pain , 17(4), S46, 2016
Created on 2017-01-23 15:40:30,
Last reviewed on 2017-02-28 12:12:34 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.