IthaID: 3145

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs1984112	HGVS Name:	NG_008192.1:g.16417A>G

Context nucleotide sequence:
TTTACTGAACAGGAAACTGTAGTTA [A/G] GAAGTAAAAATCACAGTGAAAAATT (Strand: +)

Also known as:

Comments: SNP (G allele) associated with a higher level of reticulocyte count in Portuguese (Sub-Saharan African ancestry) and Tunisian children with sickle cell disease (SCD). It showed weak association with vaso-occlusive crisis in the Tunisian SCD cohort.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Vaso-occlusive crisis Reticulocytosis [HP:0001923]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	7
Locus:	NG_008192.1
Locus Location:	16417
Size:	1 bp
Located at:	CD36
Specific Location:	Intron 1

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	Tunisian, Sub-Saharan African
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Coelho A, Dias A, Morais A, Nunes B, Ferreira E, Picanço I, Faustino P, Lavinha J, Genetic variation in CD36, HBA, NOS3 and VCAM1 is associated with chronic haemolysis level in sickle cell anaemia: a longitudinal study., Eur. J. Haematol. , 92(3), 237-43, 2014
Kalai M, Dridi M, Chaouch L, Moumni I, Ouragini H, Darragi I, Boudrigua I, Chaouachi D, Mellouli F, Bejaoui M, Abbes S, The role of rs1984112_G at CD36 gene in increasing reticulocyte level among sickle cell disease patients., Hematology , 2016

Created on 2017-01-23 11:29:08, Last reviewed on 2019-07-03 15:55:00 (Show full history)

A/A	Date	Curator(s)	Comments
1	2017-01-23 11:29:08	The IthaGenes Curation Team	Created
2	2017-01-23 11:35:17	The IthaGenes Curation Team	Reviewed. Origin updated.
3	2017-05-02 09:45:10	The IthaGenes Curation Team	Reviewed. Mutation comment modified. Clinical phenotype added.
4	2017-07-19 10:08:55	The IthaGenes Curation Team	Reviewed. Mutation info section updated.
5	2019-07-03 15:55:00	The IthaGenes Curation Team	Reviewed. Phenotype added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.