
IthaID: 3139
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs60684937 | HGVS Name: | NC_000017.11:g.69422989T>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ATCGCCACCTCCTGGGTTCAAGCGA [C/T] CCTCCTGCCTCAGCCTCCCGAGTAG (Strand: +)
Comments: The T allele associated with increased plasma EPO levels in adult SCD patients from the Walk-PHaSST, PUSH, Howard and UIC cohorts. It also associated with increased expression of a non-coding transcript of PRKAR1A gene, suggesting that this SNP may contribute to EPO regulation through a cAMP-dependent protein kinase A pathway.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | EPO levels |
Location
Chromosome: | 17 |
---|---|
Locus: | NG_029437.1 |
Locus Location: | N/A |
Size: | 1 bp |
Located at: | MAP2K6 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American, African |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Zhang X, Shah BN, Zhang W, Saraf SL, Miasnikova G, Sergueeva A, Ammosova T, Niu X, Nouraie M, Nekhai S, Castro O, Gladwin MT, Prchal JT, Garcia JG, Machado RF, Gordeuk VR, A genetic variation associated with plasma erythropoietin and a non-coding transcript of PRKAR1A in sickle cell disease., Hum. Mol. Genet. , 2016
Created on 2017-01-16 13:27:39,
Last reviewed on 2017-01-23 13:43:42 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.