
IthaID: 3135
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs2470890 | HGVS Name: | NG_008431.1:g.37544C>T | NG_008431.1:g.37544C= |
Context nucleotide sequence:
AGGCGCGGCTGCGCTTCTCCATCAA [C/T] TGAAGAAGACACCACCATTCTGAGG (Strand: +)
Also known as:
Comments: SNP associated with variability in deferasirox plasma levels in β-thalassaemia adult patients with transfusional iron overload. Patients with TT genotype had lower drug concentration and thus a higher risk for non-response.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Response to deferasirox |
Location
Chromosome: | 15 |
---|---|
Locus: | NG_008431.2 |
Locus Location: | 37544 |
Size: | 1 bp |
Located at: | CYP1A2 |
Specific Location: | Exon 7 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Italian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
Publications / Origin
- Cusato J, Allegra S, Massano D, De Francia S, Piga A, D'Avolio A, Influence of single-nucleotide polymorphisms on deferasirox C trough levels and effectiveness., Pharmacogenomics J. , 15(3), 263-71, 2015
Created on 2016-10-25 18:00:11,
Last reviewed on 2016-10-26 09:26:42 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-10-25 18:00:11 | The IthaGenes Curation Team | Created |
2 | 2016-10-26 09:26:42 | The IthaGenes Curation Team | Reviewed. Clinical phenotype section updated. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2022-08-12 10:07:42