IthaID: 3122


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs10421768 HGVS Name: NG_011563.1:g.4490A>G

Context nucleotide sequence:
AAGGGTCTGACACTGGGAAAACACC [A/G] CGTGCGGATCGGGCACACGCTGATG (Strand: +)

Also known as:

Comments: SNP (allele A) associated with higher haemoglobin concentration in the Kenyan population [PMID: 27332551]. Variant associated with higher liver iron concentration and serum ferritin levels in poly-transfused β-thalassaemia patients of Middle Eastern descend from Italy [PMID: 19734422]. Not associated with serum iron/transferrin/ferritin levels in the healthy Galician population [PMID: 21143959].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Increased serum ferritin [HP:0003281]
Increased liver iron level [HP:0012465]
Anaemia [HP:0001903]

Location

Chromosome: 19
Locus: NG_011563.1
Locus Location: 4490
Size: 1 bp
Located at: HAMP
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African, Middle Eastern
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Andreani M, Radio FC, Testi M, De Bernardo C, Troiano M, Majore S, Bertucci P, Polchi P, Rosati R, Grammatico P, Association of hepcidin promoter c.-582 A>G variant and iron overload in thalassemia major., Haematologica, 94(9), 1293-6, 2009
  2. Parajes S, González-Quintela A, Campos J, Quinteiro C, Domínguez F, Loidi L, Genetic study of the hepcidin gene (HAMP) promoter and functional analysis of the c.-582A > G variant., BMC Genet., 11(0), 110, 2010
  3. Gichohi-Wainaina WN, Tanaka T, Towers GW, Verhoef H, Veenemans J, Talsma EF, Harryvan J, Boekschoten MV, Feskens EJ, Melse-Boonstra A, Associations between Common Variants in Iron-Related Genes with Haematological Traits in Populations of African Ancestry., PLoS ONE , 11(6), e0157996, 2016
Created on 2016-10-06 11:51:51, Last reviewed on 2019-07-03 23:14:54 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.