IthaID: 3104


Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs2855039 HGVS Name: NG_000007.3:g.47175G>A

Context nucleotide sequence:
TGGCTTTATAGAAATTGTTTTCACT [A/G] CACTATTGAGAAATTAAGAGATAAT (Strand: -)

Also known as:

Comments: SNP associated with disease severity and HbF levels in Thai β0-thalassaemia/HbE patients.

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 47175
Size: 1 bp
Located at:
Specific Location: Intron 2

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Thai
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Publications / Origin

  1. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010
Created on 2016-09-28 09:53:45, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.