IthaID: 3086

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1800469 HGVS Name: NG_013364.1:g.4536T>C

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGTCTGCCTCCTGACCCTTCCATCC [C/T] TCAGGTGTCCTGTTGCCCCCTCCTC (Strand: -)

Comments: The TGFB1 (-509)C allele is highly frequent among Brazilian patients with sickle cell disease (n=240).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: N/A

Location

Chromosome: 19
Locus: NG_013364.1
Locus Location: 4536
Size: 1 bp
Located at: TGFB1
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Brazilian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Torres LS, Belini Júnior E, Silva DG, Lobo CL, Ruiz MA, Bonini-Domingos CR, Frequencies of -308G/A (TNFA) and -509C/T (TGFB1) polymorphisms in sickle cell anemia patients from Brazil., Genet. Mol. Res. , 12(4), 6762-6, 2013
Created on 2016-09-12 16:43:05, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.