IthaID: 3085
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs200434923 | HGVS Name: | NG_012856.2:g.45214_45218delCCCCA |
Context nucleotide sequence:
GTCCACAGCACCGTGGAGGCCATGC [-/TGGGG] TGGGGTGGGGTGGGGTGGGGTGGGG (Strand: +)
Also known as:
Comments: SNP associated with low hepcidin levels in patients with beta-thalassaemia major (n=130).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Abnormal hepcidin level [HP:0031875] |
Location
| Chromosome: | 22 |
|---|---|
| Locus: | NG_012856.2 |
| Locus Location: | 45214 |
| Size: | 5 bp |
| Located at: | TMPRSS6 |
| Specific Location: | Intron 17 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Consensus splice site (mRNA Processing) |
| Ethnic Origin: | Indian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Athiyarath R, George B, Abraham A, Viswabandya A, Srivastava A, Edison ES, Genetic modifiers of secondary iron overload in beta thalassemia major., Blood Cells Mol. Dis. , 54(3), 242-3, 2015
Created on 2016-09-12 16:24:23,
Last reviewed on 2019-07-02 16:32:55 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.