IthaID: 3060
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
|---|---|---|---|
| Common Name: | -42 C>G | HGVS Name: | HBB:c.-92C>G |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
TCCCAGGAGCAGGGAGGGCAGGAGC [C/G] AGGGCTGGGCATAAAAGTCAGGGCA (Strand: +)
Also known as:
Comments: Conflicting classifications of pathogenicity
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70503 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Pakistani |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Nagar R, Sinha S, Raman R, Genotype-phenotype correlation and report of novel mutations in β-globin gene in thalassemia patients., Blood Cells Mol. Dis. , 55(1), 10-4, 2015
- Yasmeen H, Toma S, Killeen N, Hasnain S, Foroni L, The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population., Eur J Med Genet , 59(8), 355-62, 2016
Created on 2016-09-02 14:33:15,
Last reviewed on 2024-06-26 15:43:05 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.