IthaID: 3057
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 90 (+24 bp) (+AGCTGCACTGTGACAAGCTGCACG) | HGVS Name: | HBB:c.272_295dup |
Hb Name: | N/A | Protein Info: | N/A |
Also known as:
Comments: Found in combination with the haemoglobin (Hb) variant Hb N-Baltimore, in cis, in two members of a family (mother and daughter), presenting with typical features of β-thal major or intermedia depending on their α-globin genotypes.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70996 |
Size: | 24 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
Ethnic Origin: | Iranian |
Molecular mechanism: | N/A |
Inheritance: | Dominant |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Farashi S, Rad F, Shahmohammadi B, Imanian H, Azarkeivan A, Najmabadi H, First Report of a Dominantly Inherited β-Thalassemia Caused by a Novel Elongated β-Globin Chain., Hemoglobin , 40(2), 102-7, 2016
Created on 2016-09-02 13:20:19,
Last reviewed on 2021-12-09 12:20:35 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-09-02 13:20:19 | The IthaGenes Curation Team | Created |
2 | 2016-09-02 13:41:58 | The IthaGenes Curation Team | Reviewed. |
3 | 2019-11-11 11:39:01 | The IthaGenes Curation Team | Reviewed. Mutation names and Location corrected. Comment added. |
4 | 2021-12-09 12:20:35 | The IthaGenes Curation Team | Reviewed. Effect on protein function corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07