IthaID: 3057
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 90 (+24 bp) (+AGCTGCACTGTGACAAGCTGCACG) | HGVS Name: | HBB:c.272_295dup |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Comments: Found in combination with the haemoglobin (Hb) variant Hb N-Baltimore, in cis, in two members of a family (mother and daughter), presenting with typical features of β-thal major or intermedia depending on their α-globin genotypes.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70996 |
| Size: | 24 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | Iranian |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Farashi S, Rad F, Shahmohammadi B, Imanian H, Azarkeivan A, Najmabadi H, First Report of a Dominantly Inherited β-Thalassemia Caused by a Novel Elongated β-Globin Chain., Hemoglobin , 40(2), 102-7, 2016
Created on 2016-09-02 13:20:19,
Last reviewed on 2021-12-09 12:20:35 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.