IthaID: 3025

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -114 C>G HGVS Name: HBG1:c.-167C>G
Hb Name: N/A Protein Info: N/A
Also known as: African-American/Hispanic non-deletional HPFH

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
ATGGGTTGGCCAGCCTTGCCTTGAC [C>G] AATAGCCTTGACAAGGCAAACTTGA (Strand: +)

Comments: Subject presented with Hb S-beta(+) thalassaemia and elevated HbF. Disrupts binding site (TGACCA) of BCL11A transcriptional repressor.

External Links

No available links

Phenotype

Hemoglobinopathy Group: HPFH
Hemoglobinopathy Subgroup: HPFH
Allele Phenotype:HPFH
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 47645
Size: 1 bp
Located at:
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: African American/Hispanic
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Akinbami AO, Campbell AD, Han ZJ, Luo HY, Chui DH, Steinberg MH, Hereditary Persistence of Fetal Hemoglobin Caused by Single Nucleotide Promoter Mutations in Sickle Cell Trait and Hb SC Disease., Hemoglobin , 40(1), 64-5, 2016
Created on 2016-08-26 08:50:44, Last reviewed on 2020-10-08 13:47:58 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.