IthaID: 3025
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -114 C>G | HGVS Name: | HBG1:c.-167C>G |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: | African-American/Hispanic non-deletional HPFH |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ATGGGTTGGCCAGCCTTGCCTTGAC [C>G] AATAGCCTTGACAAGGCAAACTTGA (Strand: +)
Comments: Subject presented with Hb S-beta(+) thalassaemia and elevated HbF. Disrupts binding site (TGACCA) of BCL11A transcriptional repressor.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | HPFH |
|---|---|
| Hemoglobinopathy Subgroup: | HPFH |
| Allele Phenotype: | HPFH |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 47645 |
| Size: | 1 bp |
| Located at: | Aγ |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | African American/Hispanic |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Akinbami AO, Campbell AD, Han ZJ, Luo HY, Chui DH, Steinberg MH, Hereditary Persistence of Fetal Hemoglobin Caused by Single Nucleotide Promoter Mutations in Sickle Cell Trait and Hb SC Disease., Hemoglobin , 40(1), 64-5, 2016
Created on 2016-08-26 08:50:44,
Last reviewed on 2020-10-08 13:47:58 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.